Question 1

The DNA below is replicated from left to right. Label the templates for leading strand and lagging strand synthesis.
(5')ACTTCGGATCGTTAAGGCCGCTTTCTGT(3')
(3')TGAAGCCTAGCAATTCCGGCGAAAGACA(5')

Accepted Answer

During DNA replication, the two strands ...

Question 2

Briefly describe the role of recombination in the generation of antibody (immunoglobin) diversity.

Accepted Answer

Recombination plays a crucial role in th...

Question 3

Outline the key steps that occur during crossing over during meiosis in animal germ-line cells.

Accepted Answer

During crossing over in meiosis, several...

Question 4

The repair of cyclobutane pyrimidine dimers by bacterial DNA photolyase involves the cofactor:

Accepted Answer

A)   coenzyme A.
B)   coenzyme Q.
C)   FADH-.
D)   pyridoxal phosphate (PLP) .
E)   thiamine pyrophosphate (TPP) .F) D) and E)
G) A) and E)

Question 5

Which process does NOT require the 5' to 3' exonuclease activity of Pol I in E. coli?

Accepted Answer

A)   joining of Okazaki fragments
B)   nucleotide-excision repair
C)   base-excision repair
D)   nick translation
E)   All of these require the 5' to 3' exonuclease activity of Pol I.F) A) and D)
G) A) and C)

Question 6

Outline the four key features of the current model for homologous recombination during meiosis in a eukaryotic cell.

Accepted Answer

The four key features of the current mod...

Question 7

What is an Okazaki fragment? What enzyme(s) is (are) required for its formation in E. coli?

Accepted Answer

An Okazaki fragment is a short segment o...

Question 8

Which process or aspect is NOT associated with RecBCD?

Accepted Answer

A)   helicase activity
B)   ATP hydrolysis
C)   nuclease activity
D)   sequence-specific binding interactions
E)   generation of 5' overhangsF) A) and B)
G) A) and C)

Question 9

Briefly describe the biochemical role of the following enzymes in DNA replication in E. coli:
(a) DNA helicase; (b) primase; (c) the 3' $\rightarrow$ 5' exonuclease activity of DNA polymerase; (d) DNA 1igase; (e) topoisomerases; (f) the 5' $\rightarrow$ 3' exonuclease activity of DNA polymerase I.

Accepted Answer

(a) DNA helicase: DNA helicase is respon...

Question 10

When bacterial DNA replication introduces a mismatch in a double-stranded DNA, the methyl-directed repair system:

Accepted Answer

A)   cannot distinguish the template strand from the newly replicated strand.
B)   changes both the template strand and the newly replicated strand.
C)   corrects the DNA strand that is methylated.
D)   corrects the mismatch by changing the newly replicated strand.
E)   corrects the mismatch by changing the template strand.F) A) and B)
G) A) and C)

Question 11

List three types of DNA damage that require repair.

Accepted Answer

DNA is constantly subject to damage from...

Question 12

In E. coli replication, DNA gyrase does not require ATP hydrolysis to lower the linking number of its substrate. Why is this, and where does the energy come from?

Accepted Answer

The statement in the question is incorre...

Question 13

Nucleotide polymerization appears to be a thermodynamically balanced reaction (because one phosphodiester bond is broken and one is formed). Nevertheless, the reaction proceeds efficiently both in a test tube and in the cell. Explain.

Accepted Answer

Nucleotide polymerization is a thermodyn...

Question 14

The Ames test is used to:

Accepted Answer

A)   detect bacterial viruses.
B)   determine the rate of DNA replication.
C)   examine the potency of antibiotics.
D)   measure the mutagenic effects of various chemical compounds.
E)   quantify the damaging effects of UV light on DNA molecules.F) B) and E)
G) A) and B)

Question 15

Many bases in DNA are susceptible to spontaneous deamination. Which of the standard bases in DNA CANNOT spontaneously deaminate?

Accepted Answer

Among the standard bases in DNA, which i...

Question 16

Which statement is FALSE?

Accepted Answer

A)   In vitro, the strand-exchange reaction can include formation of a Holliday intermediate.
B)   In vitro, the strand-exchange reaction is accompanied by ATP hydrolysis.
C)   In vitro, the strand-exchange reaction may involve transient formation of a three- or four-stranded DNA complex.
D)   In vitro, the strand-exchange reaction needs RecA protein.
E)   In vitro, the strand-exchange reaction requires DNA polymerase.F) A) and B)
G) D) and E)

Question 17

Which enzyme is NOT directly involved in methyl-directed mismatch repair in E. coli?

Accepted Answer

A)   DNA glycosylase
B)   DNA helicase II
C)   DNA ligase
D)   DNA polymerase III
E)   exonuclease IF) B) and E)
G) B) and D)

Question 18

What is NOT a process or characteristic associated with recA?

Accepted Answer

A)   It binds to ssDNA.
B)   It forms part of DNA polymerase V.
C)   It is involved in the homologous genetic recombination.
D)   It facilitates strand invasion in repair pathways.
E)   It forms a dimer with single-stranded DNA binding protein (SS
B)   and single-stranded DNA.F) C) and D)
G) B) and E)

Question 19

Which phrase does NOT describe an aspect of the nucleotide addition reaction catalyzed by E. coli DNA Pol III?

Accepted Answer

A)   activation of the 3' OH of the newly synthesized strand by a metal ion
B)   a properly positioned phosphate
C)   specific protein/base-pair interactions in the major groove
D)   charge stabilization of all three phosphates on the substrate
E)   All of these are important aspects of the addition reaction.F) C) and D)
G) A) and E)

Question 20

The function of the eukaryotic DNA replication factor PCNA (proliferating cell nuclear antigen)  is similar to that of the  β\betaβ  subunit of bacterial DNA polymerase III in that it:

Accepted Answer

A)   facilitates replication of telomeres.
B)   forms a circular sliding clamp to increase the processivity of replication.
C)   has a 3ʹ →\rightarrow→  5ʹ proofreading activity.
D)   increases the speed but not the processivity of the replication complex.
E)   participates in DNA repair. F) A) and B)
G) A) and D)

Exam 25: DNA Metabolism

Which phrase does NOT describe an aspect of the nucleotide addition reaction catalyzed by E. coli DNA Pol III?

Correct AnswerverifiedShow Answer

The Ames test is used to:

Correct AnswerverifiedShow Answer

List three types of DNA damage that require repair.

Correct AnswerAnswered by ExamLex AIDNA is constantly subject to damage from...View AnswerShow Answer

Nucleotide polymerization appears to be a thermodynamically balanced reaction (because one phosphodiester bond is broken and one is formed). Nevertheless, the reaction proceeds efficiently both in a test tube and in the cell. Explain.

Correct AnswerAnswered by ExamLex AINucleotide polymerization is a thermodyn...View AnswerShow Answer

Outline the four key features of the current model for homologous recombination during meiosis in a eukaryotic cell.

Correct AnswerAnswered by ExamLex AIThe four key features of the current mod...View AnswerShow Answer

The function of the eukaryotic DNA replication factor PCNA (proliferating cell nuclear antigen) is similar to that of the β\betaβ subunit of bacterial DNA polymerase III in that it:

Correct AnswerverifiedShow Answer

Many bases in DNA are susceptible to spontaneous deamination. Which of the standard bases in DNA CANNOT spontaneously deaminate?

Correct AnswerAnswered by ExamLex AIAmong the standard bases in DNA, which i...View AnswerShow Answer

Which process or aspect is NOT associated with RecBCD?

Correct AnswerverifiedShow Answer

Which enzyme is NOT directly involved in methyl-directed mismatch repair in E. coli?

Correct AnswerverifiedShow Answer

When bacterial DNA replication introduces a mismatch in a double-stranded DNA, the methyl-directed repair system:

Correct AnswerverifiedShow Answer

The DNA below is replicated from left to right. Label the templates for leading strand and lagging strand synthesis. (5')ACTTCGGATCGTTAAGGCCGCTTTCTGT(3') (3')TGAAGCCTAGCAATTCCGGCGAAAGACA(5')

Correct AnswerAnswered by ExamLex AIDuring DNA replication, the two strands ...View AnswerShow Answer

Which statement is FALSE?

Correct AnswerverifiedShow Answer

The repair of cyclobutane pyrimidine dimers by bacterial DNA photolyase involves the cofactor:

Correct AnswerverifiedShow Answer

Which process does NOT require the 5' to 3' exonuclease activity of Pol I in E. coli?

Correct AnswerverifiedShow Answer

Briefly describe the role of recombination in the generation of antibody (immunoglobin) diversity.

Correct AnswerAnswered by ExamLex AIRecombination plays a crucial role in th...View AnswerShow Answer

What is an Okazaki fragment? What enzyme(s) is (are) required for its formation in E. coli?

Correct AnswerAnswered by ExamLex AIAn Okazaki fragment is a short segment o...View AnswerShow Answer

Outline the key steps that occur during crossing over during meiosis in animal germ-line cells.

Correct AnswerAnswered by ExamLex AIDuring crossing over in meiosis, several...View AnswerShow Answer

What is NOT a process or characteristic associated with recA?

Correct AnswerverifiedShow Answer

Correct AnswerAnswered by ExamLex AI(a) DNA helicase: DNA helicase is respon...View AnswerShow Answer

In E. coli replication, DNA gyrase does not require ATP hydrolysis to lower the linking number of its substrate. Why is this, and where does the energy come from?

Correct AnswerAnswered by ExamLex AIThe statement in the question is incorre...View AnswerShow Answer

Correct Answer
verified

Correct Answer
verified

Correct Answer
Answered by ExamLex AI
DNA is constantly subject to damage from...
View Answer

Correct Answer
Answered by ExamLex AI
Nucleotide polymerization is a thermodyn...
View Answer

Correct Answer
Answered by ExamLex AI
The four key features of the current mod...
View Answer

The function of the eukaryotic DNA replication factor PCNA (proliferating cell nuclear antigen) is similar to that of the $\beta$ subunit of bacterial DNA polymerase III in that it:

Correct Answer
verified

Correct Answer
Answered by ExamLex AI
Among the standard bases in DNA, which i...
View Answer

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
Answered by ExamLex AI
During DNA replication, the two strands ...
View Answer

Correct Answer
verified

Correct Answer
verified

Correct Answer
verified

Correct Answer
Answered by ExamLex AI
Recombination plays a crucial role in th...
View Answer

Correct Answer
Answered by ExamLex AI
An Okazaki fragment is a short segment o...
View Answer

Correct Answer
Answered by ExamLex AI
During crossing over in meiosis, several...
View Answer

Correct Answer
verified

Correct Answer
Answered by ExamLex AI
(a) DNA helicase: DNA helicase is respon...
View Answer

Correct Answer
Answered by ExamLex AI
The statement in the question is incorre...
View Answer